Trait bio::data_structures::fmindex::FMIndexable [−] [src]

pub trait FMIndexable {
    fn occ(&self, r: usize, a: u8) -> usize;
    fn less(&self, a: u8) -> usize;
    fn bwt(&self) -> &BWT;

    fn backward_search<'b, P: Iterator<Item=&'b u8> + DoubleEndedIterator>(&self, pattern: P) -> Interval { ... }
}

Required Methods

fn occ(&self, r: usize, a: u8) -> usize

Get occurrence count of symbol a in BWT[..r+1].

fn less(&self, a: u8) -> usize

Also known as

fn bwt(&self) -> &BWT

Provided Methods

fn backward_search<'b, P: Iterator<Item=&'b u8> + DoubleEndedIterator>(&self, pattern: P) -> Interval

Perform backward search, yielding suffix array interval denoting exact occurrences of the given pattern of length m in the text. Complexity: O(m).

Arguments

  • pattern - the pattern to search

Example

use bio::data_structures::bwt::{bwt, less, Occ};
use bio::data_structures::fmindex::{FMIndex, FMIndexable};
use bio::data_structures::suffix_array::suffix_array;
use bio::alphabets::dna;

let text = b"GCCTTAACATTATTACGCCTA$";
let alphabet = dna::n_alphabet();
let sa = suffix_array(text);
let bwt = bwt(text, &sa);
let less = less(&bwt, &alphabet);
let occ = Occ::new(&bwt, 3, &alphabet);
let fm = FMIndex::new(&bwt, &less, &occ);

let pattern = b"TTA";
let sai = fm.backward_search(pattern.iter());

let positions = sai.occ(&sa);

assert_eq!(positions, [3, 12, 9]);

Implementors